Frontiers

Brucella, the intracellular bacteria, have evolved subtle strategies to efficiently survive and replicate in macrophages. However, the virulence effector proteins involved are still unclear. LysR-type transcriptional regulators (lttrs) are the largest regulator family with diverse function in prokaryotes. However, very little is known about the role of LysR regulators in the Brucella spp. Here, a BSS2_II0858 gene, encoded as one of the LysR-type regulators, was studied. We successfully constructed a BSS2_II0858 deletion mutant, Δ0858, and complementation strain CΔ0858 in Brucella suis S2. The cell apoptosis induced by B. suis S2 and its derivatives were detected by flow cytometry. The autophagy was then assessed by immunoblot analysis using the IL3I/II and p62 makers. In addition, the autophagy flux was evaluated by double fluorescent labeling method for autophagy marker protein LC3. Our studies demonstrated that B. suis S2 and its derivatives inhibited the programmed cell death in early stage and promoted apoptosis in the later stage during infection in RAW264.7 cells. The BSS2_II0858 gene was found to play no role during apoptosis according to these results. Compared with the wild-type strain, Δ0858 mutant can stimulate the conversion of LC3-I to LC3-II and markedly inhibited the autophagy flux at early stage leading to obvious autophagosome accumulation. This study explored the function of BSS2_II0858 gene and may provide new insights for understanding the mechanisms involved in the survival of Brucella in macrophages.

Brucellosis has been recognized as the most serious common zoonosis globally caused by Brucella species (Atluri et al., 2011). In livestock, Brucella disrupts reproductive processes causing abortions and infertility and bringing severe economic losses (Boschiroli et al., 2001; Atluri et al., 2011). The central role in the pathogenicity of Brucella is its ability to evade the antimicrobial processes and replicate intracellularly in host cells (Boschiroli et al., 2002). After phagocytic uptake and internalization, Brucella locates within the Brucella-containing vacuole (BCV) to escape killing by the host’s immune system. During transient interaction with the endolysosomal network, the BCV undergo maturation and acidification to trigger the expression of the type IV secretion system (T4SS). The effector of T4SS controls BCV fusion with the endoplasmic reticulum (ER) to establish a replicative BCV (Celli, 2015; Celli, 2019).

Autophagy acts as a housekeeper to maintain cellular homeostasis by eliminating invading bacteria through an autophagic phenomenon: xenophagy (Sharma et al., 2018; Wang and Li, 2020). In eukaryotic cells, intracellular pathogens trigger the xenophagy pathway by forming autophagosomes, fusion with lysosomes, and finally degradation in autolysosomes (Bauckman et al., 2015; Kwon and Song, 2018). This whole dynamic process is referred to as autophagy flux. Microtubule-associated protein light chain 3 (LC3) cleaved by Atg4 to form LC3-I and then conversed into a membrane-bound form (LC3-II) by Atg7/Atg3 in the initiation of autophagy. p62 targets ubiquitinated protein into autophagy vesicles and substrates in autolysosomes via interaction with LC3B (Klionsky et al., 2012). Although xenophagy constitutes a powerful host-defense mechanism against invading pathogens, various intracellular microbes have developed dichotomous strategy to subvert xenophagy to establish infection through transcriptional regulators, lipopolysaccharide, and the type IV secretion system (Brumell, 2012; Guo et al., 2012; Wang et al., 2017; Sharma et al., 2018; Celli, 2019).

LysR-type transcriptional regulators (lttrs) comprise the largest family of DNA-binding proteins in prokaryotes. lttrs have an N-terminal DNA-binding helix-turn-helix motif and a C-terminal coinducer-binding domain as conserved structures (Maddocks and Oyston, 2008). These regulators are highly conserved in protein structure and ubiquitous among bacteria, which means that they have a similar diverse function with virulence, motility, metabolism, quorum sensing, scavenging of oxidative stressors, and toxin production (Maddocks and Oyston, 2008). There are more than twenty different LysR regulators in Brucella. The gene of BABI_1517, subsequently named vtlR was identified as a Brucella virulence-associated transcriptional LysR-family regulator. However, very little is known about the role of other LysR regulators in Brucella evasion of host autophagy.

In this study, a lysr mutant Brucella strain (△0858) has been constructed by allelic exchange to investigate the role of lysr (BSS2_II0858) in Brucella suis S2 virulence during infection. The characteristics of autophagy induced by B. suis S2, △0858, and C△0858-infected RAW264.7 macrophage cells were systematically described by detecting autophagic flux-related indicators and assessing lysosomal functions.

Escherichia coli DH5α was purchased from TakaRa and grown in Luria-Bertani (LB) broth at 37°C and 200 rpm. Wild-type Brucella suis S2 strain was obtained from the Shaanxi Provincial Institute for Veterinary Drug Control (Xi’an, Shaanxi, China). B. suis S2 and its derivatives were grown at 37°C on rich medium tryptic soy agar (TSA) for 72 h or in tryptic soy broth (TSB) with shaking for 48 h. The murine-derived macrophage line RAW 264.7 cell were cultured in DMEM (Hyclone, Logan, UT, USA) supplemented with 10% FBS at 37°C with 5% CO2.

The BSS2_II0858 gene deletion strains were created by allelic exchange as described previously with minor modifications (Zhi et al., 2021). Briefly, 769-bp upstream fragment, 805-bp downstream fragment, and kanamycin resistance gene were amplified by PCR using primers upstream (lysr)-F-CGGTCCTGACCACCCATTTGCCGTTCTTTT and upstream (lysr)-R-ACTTCAAGAACTCTGTAGCACCGCATTGTTGCGCAAATAACGCTGTCC, K+(lysr)-F-GGACAGCGTTATTTGCGCAACAATGCGGTGCTACAGAGTTCTTGAAGT and K+(lysr)-R-CAACTATGTTAATGCGAGAATGGACAGGTGGCACTTTTCGGGGAAATG, and downstream (lysr3)-F-CATTTCCCCGAAAAGTGCCACCTGTCCATTCTCGCATTAACATAGTTG and downstream (lysr)-R-TGAAGGAAACGACATCGGCGATCAGGCGAT, respectively. The purified upstream, kanamycin resistance, and downstream PCR products were overlapped together using primers upstream (LysR)-F and downstream (LysR)-R, then ligated with the linearized pMD-19T vector to generate pMD19-T-LysR for allelic exchange. The recombined plasmid was electrically transformed into chemically competent B. suis S2 cells. Transformants were cultured and selected on TSA with 25 μg/ml kanamycin for 72 h. Colonies were screened and verified by colony PCR amplification using LysR-upF CGGCGCATTGGTATAGGCATTGG and K+(LysR)-R primer pairs and K+(LysR)-F 2-downR GCGTCAGGTGGTTGATGTGC primer pairs to identify the clone mutant BSS2_II0858 containing inserts of the predicted size for kanamycin.

The BSS2_II0858 complementation strain was constructed using the expression vector pBBR1-MCS4 by native promoters. Briefly, a region with the lysr promoter and lysr gene were amplified by PCR using primers lysr (C)-F-TGCGAAAATTTCCGTTGAAAGGG and lysr (C)-R-TCAAGCGTAGTCTGGGACGTCGTATGGGTATTCCGGTTTGGAATGAACCA. The purified fragment was inserted into pBBR1-MCS4 to form the pBBR1-MCS4-lysr. This plasmid was transformed into the Δ0858 strain by electroporation to generate lysr complementation strain (CΔ0858).

To verify the transcriptional level of the lysr gene in mutant and complementation strain, total RNA was extracted from wild-type B. suis S2, BSS2_II0858 mutant, and complementation strains by TRIzol reagent (Invitrogen, Inc., Carlsbad, CA, United States). The bacterial genomic contamination was removed using the TURBO DNA-Free Kit (Ambion Inc, Austin, TX). RT-PCR was performed using GoTaq qPCR Master Mix (Promega Corporation, Wisconsin, USA) to generate products corresponding to lysr and 16S rRNA. Primer pairs for BSS2_II0858 were as follows: LysR real-time F 5′-CGTCATTCAGCATCGCAACC-3′ and LysR realtime R 5′-TGCAACAGGAACGATCACCT-3′. RT-PCR conditions were 95°C for 5 min followed by 30 cycles of 95°C, 60°C, and 72°C for 30 s each. The relative transcription levels were determined by the 2−ΔΔCt method.

Infection assays of the wild-type strain and its derivatives were performed as described previously (Wang et al., 2016). Briefly, RAW264.7 macrophages were seeded into plates at a density of 5 × 105 cells/ml and cultured for 24 h. The confluent monolayers were inoculated with wild-type B. suis S2, BSS2_II0858 mutant, and complementation strains at a multiplicity of infection (MOI) of 100. Also, cell plates were centrifuged at 500×g for 10 min for bacterial sedimentation and culture for 1 h for bacterial infection. Cells were then washed three times to remove extracellular bacteria and further incubated with medium containing 50 µg/ml of gentamicin for 1 h to eliminate extracellular bacteria. After washing for three times, the culture medium was replaced by a medium with 25 µg/ml of gentamicin. At the desired time points, the cells were subjected to the following procedures.

The flow cytometry analysis was performed following the standard protocol. Briefly, after 24- or 48-h bacterial infection, different sets of RAW264.7 were washed three times with cold PBS by centrifugation. Cells were treated with PI and Annexin V-FITC for 30 min at 4°C in the dark. The cells were then analyzed by flow cytometry (EPICS Altra, Beckman Coulter Cytomics Altra). The scatter plots of PI fluorescence (y-axis) vs. FITC fluorescence (x-axis) were primed.

Western blotting analysis was performed to verify the complementation strain CΔ0858 and to detect the expression of autophagy-related proteins in Brucella-infected cells. For verification, the complementation strain, the fresh cultural B. suis. S2, Δ0858, and CΔ0858 strains were harvested and washed in phosphate-buffered saline. After centrifugation at 8,000×g for 5 min, the pellets were resuspended in SDS-PAGE loading buffer. For autophagy analysis, the infected cell were collected at specific times, and then lysed with RIPA buffer (Sigma-Aldrich Corp., St. Louis, MO, USA) on ice for 30–45 min. Supernatants were collected by centrifugation at 14,000 rpm for 15 min in 4°C. Protein concentrations were determined by BCA assay and then resuspended in SDS-PAGE loading buffer. All samples were heated at 100°C for 5 min. Proteins were separated by SDS-PAGE and transferred onto PVDF membrane. The blots were blocked for 2 h at room temperature with 5% skim milk, and then probed overnight with mouse anti-HA monoclonal antibody (1:2,000, Sigma), anti-LC3 antibody (1:1,000, Sigma L7543), or β-actin (1:1,000, Beijing CWBIO, Beijing, China) as a loading control at 4°C. After washing, the membranes were incubated with secondary antibody conjugated to horseradish peroxidase at room temperature for 1 h. Immunodetection of proteins was visualized through ECL=enhanced chemiluminescence kit (Millipore Corp, Bedford, MA). The blots were visualized using the Gel Image System (Tannon, Biotech, Shanghai, China) and quantified by ImageJ Software. All bands were normalized to a loading control.

After 24 or 48 h infection with bacteria, different sets of RAW264.7 were washed twice with cold PBS and then fixed with 4% paraformaldehyde. After incubation with 0.25% Triton X-100, slides were first incubated with goat anti-Brucella polyclonal antibody (1:100), rabbit anti-LC3B polyclonal antibody (Abcam, Cambridge, UK 1:300), and then stained with donkey anti-goat Alexa Fluor 555 (1:1,000) or donkey anti-rabbit FITC (1:500 dilution, Invitrogen). The nuclei were stained with 100 µl DAPI. Images were conducted on the Nikon A1R-Si confocal microscope system. Assays were performed in triplicate.

Autophagy flux was investigated using the reporter plasmid pCMV-mCherry-GFP-LC3B (Beyotime Biotechnology, China). RAW264.7 cells were transfected with pCMV-mCherry-GFP-LC3B using Lipofectamine 8000 (Beyotime Biotechnology, China) for 24 h. The cells were then infected following macrophage infection procedure, and the fluorescent was observed with a confocal microscope (TCS SPE, Leica, Germany). Representative cells were selected and photographed.

Data were imported into GraphPad Prism 6.0 software (GraphPad Software Inc., La Jolla, CA, USA) for analysis. Statistical significance was determined using two-way ANOVA followed by Holm–Sidak’s multiple test or Chi-square test. A probability (p)-value of